Products/Services for Gentec Gas Regulators
-
Gas Pressure Regulators - (291 companies)Gas pressure regulators reduce high-pressure gas in a cylinder or process line to a lower, usable level as it passes to another piece of equipment. They also maintain pressure within a gas delivery system. Gas pressure regulators are not flow... -
Pressure Regulators - (1232 companies)Pressure regulators are used to maintain a constant outlet pressure or flow. Pressure regulators are used to reduce the pressure in a system to a lower pressure or to regulate system pressure at the desired value. Among the types of pressure... -
Gas Valves - (535 companies)Gas valves are used to handle and control the flow of gaseous media such as liquefied petroleum and natural gas. They are made of metal or plastic and vary in terms of valve size, pressure rating, number of ports, and flow. Gas valves are flow... -
Air Pressure Regulators - (402 companies)...for air pressure regulators vary considerably. Air pressure regulators are found in many common applications such as in gas grills, propane pressure control, and in medical/dental equipment to regulate oxygen and anesthesia gases. Three functional... -
Gas Instruments - (909 companies)Gas instruments detect, monitor or analyze gases present in an environment. Detectors sense situations outside normal operating parameters and are set to alarm when these conditions are violated. Monitors are also set up to alarm, but their role... -
Filter, Regulator, Lubricator (FRL) Assemblies - (416 companies)Filter, regulator, lubricator (FRL) assemblies are pre-packaged or modular assemblies of air filters, regulators, lubricators, and gauges. Filter, regulator, lubricator (FRL) assemblies are pre-packaged or modular assemblies of air filters, pressure...
-
Gas Sensors - (598 companies)Gas sensors interact with a gas to initiate the measurement of its concentration. The sensor then provides output to an instrument to display the measurements. Image Credit: Rosemount Analytical | Mettler-Toledo Process Analytics. Gas sensors...
-
Gas Cylinders - (116 companies)...protects the valve assembly from damage when the gas is not in use. A pressure regulator assembly is utilized when dispensing gas from a cylinder to control the flow of gas at the desired pressure. Applications. Gas cylinders are used in a wide...
-
Hydraulic Pressure Regulators - (95 companies)Hydraulic regulators minimize pressure fluctuations in a hydraulic circuit by relieving overpressure conditions. Hydraulic pressure regulators maintain the output pressure of a hydraulic system at a set value to minimize fluctuations...
-
IC Voltage Regulators - (504 companies)IC voltage regulators are three-terminal devices that provide a constant DC output voltage that is independent of the input voltage, output load current, and temperature. IC voltage regulators are used in power supplies that hold their output...
Product News
-
Shanghai Thinktank Process Management Co., Ltd
NGP Natural Gas Pressure Regulator Maintaining stable pressure and dependable shutoff is critical in natural gas operations. Pressure fluctuation, seal wear, or valve instability can compromise plant safety, process efficiency, and equipment lifespan. The NGP Series Natural Gas Pressure Regulator is engineered to provide accurate regulation, structural durability, and operational reliability in demanding industrial environments. Key Technical Features. Wide Size Range. Available from 1/2'' to 4'', supporting diverse pipeline... (read more)Browse Pressure Relief Valves Datasheets for Shanghai Thinktank Process Management Co., Ltd -
Shenzhen Jewellok Technology Co., Ltd.
Gas Cylinder Changeover Manifold Regulator Panel High Purity Gas Cylinder Semi Automatic Changeover Manifold Regulator Panel 3000psig Stainless Steel Gas Control Panel 1/8 Npt With Gauge. A high purity gas cylinder semi-automatic changeover regulator panel is a critical system used in industries requiring uninterrupted, high-purity gas supply, such as semiconductor manufacturing, laboratories, and medical facilities. This panel ensures a continuous gas flow by automatically switching between gas cylinders when one is depleted, maintaining... (read more)Browse Manifolds and Manifold Systems Datasheets for Shenzhen Jewellok Technology Co., Ltd. -
Shenzhen Jewellok Technology Co., Ltd.
High Purity Gas Cylinder Pressure Regulators Poduct Features. * Cylinder pressure regulator. * Brass chrome plated body and bonnet for inert, reactive, flammable and oxidizing gas and mixtures up to grade 6.0. * Stainless steel 316L body and bonnet for corrosive gases. * 6 ports flexible configuration. * Stable outlet pressure. * Simple outlet pressure limitation by handwheel. * Tested for use with oxygen. Typical Applications. * Component Testing. * Calibration Systems. * Laboratory Pressure Control. * High Pressure Sampling Systems... (read more)Browse Pressure Regulators Datasheets for Shenzhen Jewellok Technology Co., Ltd. -
Shanghai Thinktank Process Management Co., Ltd
NGP series Natural Gas Pressure Regulator Reliable, Self-Operated Regulation for Natural Gas Systems. The NGP Series Natural Gas Pressure Regulator is designed for demanding gas environments requiring precise pressure control and safety shutoff. Whether regulating downstream, upstream, or differential pressures, this self-operated unit ensures system stability and prevents overpressure risks. Multi-Mode Pressure Regulation: Supports downstream, upstream, or differential control. Wide Pressure Range: Compatible with PN1.6 -6.4MPa... (read more)Browse Pressure Regulators Datasheets for Shanghai Thinktank Process Management Co., Ltd -
Shenzhen Jewellok Technology Co., Ltd.
Pressure Regulator A pressure regulator is a valve that controls the pressure of a fluid to a desired value, using negative feedback from the controlled pressure. Regulators are used for gases and liquids, and can be an integral device with a pressure setting, a restrictor and a sensor all in the one body, or consist of a separate pressure sensor, controller and flow valve. Two types are found: The pressure reduction regulator and the back-pressure regulator. A pressure reducing regulator is a control valve... (read more)Browse Pressure Regulators Datasheets for Shenzhen Jewellok Technology Co., Ltd. -
Thermon, Inc
HEA — Regulator Enclosure Heaters The Regulator Enclosure is specifically designed to provide freeze protection for a wide variety of natural gas pipeline regulators. Enclosures are designed for specific regulators and generic applications. FEATURES. Enclosure comes fully assembled. Stainless steel enclosures provide added longevity for the harshest environments. Designed to clamp directly to the pipeline, spring clamps make installation easy. Optional thermostats and regulators are available (read more)Browse Heat Tracing Datasheets for Thermon, Inc -
Shenzhen Jewellok Technology Co., Ltd.
Semiconductor Grade Regulators Jewellok DPR1 series valve is a compact high purity two-stage cylinder regulator with tied diaphragms for low flows of toxic, flammable and pyrophoric gases.Diffusion-resistant metal diaphragm seal ensures gas purity and integrity. (read more)Browse Gas Pressure Regulators Datasheets for Shenzhen Jewellok Technology Co., Ltd. -
Shenzhen Jewellok Technology Co., Ltd.
Pressure Regulators And Control Valves Product Features. * Low pressure, High flow regulator. * Brass chrome plated body for inert, reactive, flammable and oxidizing gas and mixtures up to grade 6.0. * Stainless steel 316L body for pharmaceutical, food, and beverage application. * 4 ports flexible configuration. * Stable outlet pressure. * Tested for use with oxygen. Typical Applications. * Component Testing. * Calibration Systems. * Laboratory Pressure Control. * High Pressure Sampling Systems. * Service & Test Equipment (read more)Browse Gas Pressure Regulators Datasheets for Shenzhen Jewellok Technology Co., Ltd. -
Shenzhen Xingkerong Technology Co., Ltd
Servo Regulator and Thyristor Regulator Introduction. With the acceleration of global power infrastructure construction, diversification of industrial loads, and the increasing demand for power supply stability from high-end equipment, the high-power voltage regulator market is entering a period of rapid growth. According to Global Growth Insights data, the global servo voltage regulator market is expected to reach $3.78 billion in 2024, with a compound annual growth rate of 8.27% from 2025 to 2034. Industrial demand accounts for 42%... (read more)Browse Voltage Regulators Datasheets for Shenzhen Xingkerong Technology Co., Ltd -
Beswick Engineering Co., Inc.
Pressure Regulator - Control Low Pressures The PRD pressure regulator is an excellent choice for gas and pneumatic pressure regulation applications and is particularly useful when space and weight are critical. Ideal for consistent inlet pressures, the regulator will control outlet pressures as low as (0 -30) psig. The maximum inlet supply pressure is 500 psig. Both the inlet and outlet ports are tapped 10-32 UNF. Its lightweight design allows convenient in-line mounting however a 10-32 threaded panel mount option is also offered... (read more)Browse Pressure Regulators Datasheets for Beswick Engineering Co., Inc.
More Information
Indicates content that may require registration and/or purchase.
-
rebuilding O/A torches
… my torch is but it has been around a long time and the Gentec looks and feels … That was torch, regulators , hose, goggles, etc. and Shielding Gases .
-
The auxin-signaling pathway is required for the lateral root response of Arabidopsis to the rhizobacterium Phyllobacterium brassicacearum
qPCRTM Mastermix Plus for SybrTM Green I kit (Euro- gentec , Lie`ge, Belgium), according to manufacturer rec- ommendations. Samples were extracted, purified, and analyzed by gas chromatography–selected reaction monitoring–mass spec- trometry (GC–SRM–MS) as previously described … Auxin-inducible AUX/IAA gene, transcription regulator acting as repressor of auxin-inducible gene expression 50 -TGGATTTGGTGAATAGCTGGG-30 …
-
Arabidopsis mutants affected in the transcriptional control of allene oxide synthase, the enzyme catalyzing the entrance step in octadecanoid biosynthesis
JA and its precursors have been shown to act as local regulators of AOS-gene induction in … Quantitative determination of OPDA and JA by gas chromatography–mass spectrometry (GC–MS … used in a 10-ll PCR reaction containing 0.5 lM oligonucleotides (Euro- gentec , Cologne, Germany) and …
-
Sex steroids influence glucose oxidation through modulation of insulin receptor expression and IRS-1 serine phosphorylation in target tissues of adult male rat
… phorylation of IR substrate (IRS)-1 was also studied, which is a negative regulator of insulin signaling … … qPCR SYBR green I kits were obtained from Qiagen, Hilden, Germany and Euro- gentec , Seraing, Belgium, respectively. Then, the ampoules were aerated with a gas mixture (5% CO2, 95% air) for 30 s and …
-
Mini‐chiuz
The kurzlich ertnittelte gas phase-electron diffraction-structure became now there iibcrpriift with the approach described here … The a-,P-Hamoglobin-OF eron became through determined h w e n hnologie-firm Somatogen Inc Colorado / U, manure of gangiger Kon7epte ind of specific experiences of a working group of the Gentec , Bloomfield! … has disadvantages of all sorts (naturliche): So, it loses easily the oxygen-binding regulator 2,3-Diphosphoglycerat …
-
Apple russeting as seen through the RNA-seq lens: strong alterations in the exocarp cell wall
… as global bar- rier between plants and the environment, thus limiting water, solute, gas , and ion exchanges … Plant growth regulators influence suberin synthesis-related genes. … real-time PCR instrument (Life Technologies) with Takyon SYBR Green low ROX (Euro- gentec ) following the manufacturer’s …
-
The rough endoplasmatic reticulum is a central nucleation site of siRNA‐mediated RNA silencing
… detector (Zeiss) with a  100 oil 1.4 NA objective and temperature, gas and humidity control … 50 phosphorylated miR-16, UAGCAGCACGUAAAUAUUGGCG, Euro- gentec ) was added at 10 mM and the 2D-FIDA measurement … 2005) TRBP, a regulator of cellular PKR and HIV-1 virus expression, interacts with Dicer and functions …
-
Shock Waves
These values were recomputed through calibration to energies measured with external power meter Gentec at the end … It assumes constant gas content inside the bubble and neglects evaporation, condensation, gas diffusion and heat transfer. The pressures in each plenum chamber are independently varied using a pressure regulator .
-
Process Plant Equipment: Operation Control and Reliability Complete Document
Effects of carryover include: • • • • Deposition in regulators and valves Deposition in superheaters Deposition … Porosity is the result of “ gas entrapment” in the solidifying metal. (Courtesy of Gentec Systems Corporation.) .
-
Tank waste remediation system basis for interim operations
To ensure that a representative sample is obtained, flnwmeters and regulators , flow totalizers, and vacuum pumqs contrnl … Ammonla gas mnnitors are installed in waste tank exhaust trains where ammonia may be present. 1CF KH, 1995b Gentec /mf ca7 Invest�gztion #�W u-236A, #t//tf-Flpctf/?
