Products & Services

See also: Categories | Featured Products | More Information

More Information Top

Lock Indicates content that may require registration and/or purchase. Powered by IHS Goldfire

  • Microfluidic Diagnostics
    … other hand, after PCR amplification, the solution form of agarose droplets can be switched to a solid … Conventionally, the process of digital PCR has involved sequential limiting dilutions of target DNA followed by PCR … PCR filtered pipette tips from Rainin (#RT-L10F, RT- L200F , RT-L100F).
  • Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplement...
    R & F Switched ) - rc(F, IO) Forward: GCGGAGAAGGCTGCATTC Internal: CATCGTACGCGGAAGCGTTTCGT Reverse: TGAATGAACAAATTCTACCAAAATTGA Real-time PCR Limit of Detection Screening Protocol M. 200ul filter pipette tips, (Rainin, Cat.# RT- L200F ) N. 1000ul filter pipette tips, (Rainin, Cat …
  • Genomic Applications in Pathology
    P20, P200, P1000 filtered pipet tips (Rainin, P/N RT-L10F, RT- L200F , and RT-L1000) 3. … Sequencing: A Transformative Technology 228 Implementation of Exome Sequencing in Clinical Medicine 230 Limitations and Challenges of … … the CH segment determines the antibody class (e.g., IgG, IgA, others) and allows for class switching .
  • Genomics Protocols
    Fig. 2.10 Label “ switching ” used to construct an internal standard Approximately 900–1,000nt is the very limit of resolution on an ABI 3700 DNA analyzer. … multichannel pipettes L8-200 and L8-20 and tips SR-L10F and SR- L200F (Rainin Instruments, Woburn …
  • http://dspace.mit.edu/bitstream/handle/1721.1/46642/426495118-MIT.pdf?sequence=2
    There is a transition temperature range in which the low temperature path is switched off, Another method used to increase the high load limit is to increase the inlet l200F .
  • Molecular Beacons: Signalling Nucleic Acid Probes, Methods, and Protocols
    Nos RT-L10F, RT- L200F , and RT-L1000F). This ensures that signal generation is not the rate- limiting step in a given PCR application. MBs act like switches that are normally closed to bring the fluorophore/quencher pair together to turn fluorescence …